ANCRUMKAMYIAHIN ANCRUMKAMYIAHIN

Mathematics

Answered

help please..................

Help Please class=

Answer :

MONCHI90IN MONCHI90IN

Substitute p and q with the given numbers (6 and 5) then use pemdas
18+42/6-5= 20

Answer Link

ANAKINSKYWALKER2010JIN ANAKINSKYWALKER2010JIN

Answer: 20 (Option D)

Step-by-step explanation:

I took the test.

Answer Link

In Trainings: Other Questions

Can Someone Answer This?

Trouve La Valeur De La Variabler Dans L'équation Suivante-?+ 8 = 30

In 2014, It Cost $2.89 For A Loaf Of Bread, While In 2002, The Cost Was $2.12. What Is The Percent Of Change In The Cost Of Bread?

I ONLY Need Help With The Tables ONLY! I’LL GIVE BRAINLIEST FOR THE RIGHT ANSWER?! I Please Include What You Did For Both Tables Please.

ANSWER ASAP!!!!!! PLEASE What Is The Value Of X In The Equation StartFraction 4 Over 7 EndFraction (StartFraction 21 Over 8 EndFraction X + One-half) = Negativ

What Is The Value Of X In The Equation?

The Number Of Blueberry Muffins That A Baker Makes Each Day Is 40% Of The Total Number Of Muffins She Makes. Part A: On Monday The Baker Makes 36 Blueberry Mu

EASY POINTS!! Can Someone Please Translate......

6. What Is The Smallest Whole Number That Is A Solution To 3x > 21? A6 B. 7 C. 8 D.9

The Movie Starts At 3:15 P.m. And Ends At 5:08 P.m. How Long Is The Movie?

Ehm, I Need A Bit Of Help With This. ELA Isn't My Top Class- (also Marking Brainliest C:)

TACTTAGAGGCACCACATGGGCCTTGCACT To MRNA