EMILYSTRUSSIN EMILYSTRUSSIN

Mathematics

Answered

What is the value of y?
40°
y +30
A. 1100
B. 10°
C. 55°
D. 850

Answer :

BIGBRAINSPARTAN1IN BIGBRAINSPARTAN1IN

The answer is the value of y and the correct answer is c 55…

Answer Link

In Trainings: Other Questions

30 POINTS!! The Area Of A Right Triangle Is 950 In?. The Base Of The Triangle Is 50 In. What Is The Length Of The Hypotenuse? Round To The Nearest Tenth. Enter

PLZ HELP Translate This Segment Of RNA Into The Corresponding Amino Acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember To Begin With The Start Codon "AU

R Varies Directly As P^2 And Inversely As T. When P= 8 And T = 16, R = 8. What Is The Value Of R When P =4 And T = 32?

Which Is Most Important To Keep In Mind When Revising An Informative Essay? O The Accuracy Of The Factual Support O The Accuracy Of Parenthetical Citations O Th

What Items Did Richard Use To Create His Invention? Did He Have To Buy A Lot Of Expensive Equipment? Why Or Why Not?

Does The Idea Of Working On Your Own As An Entrepreneur Appeal To You? Why Or Why Not?

“Our National Policy Is This:First, By An Impressive Expression Of The Public Will And Without Regard To Partisanship, We Are Committed To All-inclusivenational

-2x+11+6x What Is The Answer

What Is Isolation Why Would The US What Isolation ?

The Hypotenuse Of A Right Triangular Yard Is 113 Feet. One Of The Shorter Sides Of The Yard Is 15 Feet. What Is The Length Of The Other Side Of The Yard?

PLEASE HELP! Yes Or No Answer On The Graph

What Is The Rate Of Change From -11 To 9?